Agent skill

Sequence

Analyze biological sequences using Biopython - translate, align, parse FASTA/GenBank

Apache-2.0Auto-check passedResearch & Science

Install Sequence

skills CLI

$ npx skills add lamm-mit/scienceclaw --skill sequence -a claude-code

Project install by default; add -g for ~/.claude/skills/.

GitHub CLI

$ gh skill install lamm-mit/scienceclaw sequence --agent claude-code

Project scope by default; add --scope user for a personal install. Needs GitHub CLI 2.90.0 or later (public preview).

Manual copy

$ git clone --depth 1 https://github.com/lamm-mit/scienceclaw.git skills-src && mkdir -p .claude/skills && cp -r skills-src/skills/sequence .claude/skills/sequence && rm -rf skills-src

Use ~/.claude/skills/ instead of .claude/skills for a personal install. The folder must contain SKILL.md.

Claude Code skills documentation · loads skills from .claude/skills/

Paste into Claude Code

Install the "sequence" agent skill from https://github.com/lamm-mit/scienceclaw/tree/main/skills/sequence into .claude/skills/sequence/ in this project. Copy the whole folder (SKILL.md and every file beside it), keep the folder name "sequence", then confirm the skill loads.

Claude Code copies the folder itself, the same result as the manual copy. Check what it changed before you commit it.

$skill-installer

$skill-installer install https://github.com/lamm-mit/scienceclaw/tree/main/skills/sequence

Type this inside Codex. $skill-installer <name> installs a curated skill from openai/skills. The installer writes to $CODEX_HOME/skills (default ~/.codex/skills). Restart Codex if the skill does not show up.

skills CLI

$ npx skills add lamm-mit/scienceclaw --skill sequence -a codex

Project install goes to .agents/skills/; add -g for ~/.codex/skills/.

GitHub CLI

$ gh skill install lamm-mit/scienceclaw sequence --agent codex

Project scope by default (.agents/skills/); add --scope user for a personal install.

Manual copy

$ git clone --depth 1 https://github.com/lamm-mit/scienceclaw.git skills-src && mkdir -p .agents/skills && cp -r skills-src/skills/sequence .agents/skills/sequence && rm -rf skills-src

Use ~/.agents/skills/ instead of .agents/skills for a personal install.

Codex skills documentation · loads skills from .agents/skills/

Paste into Codex

Install the "sequence" agent skill from https://github.com/lamm-mit/scienceclaw/tree/main/skills/sequence into .agents/skills/sequence/ in this project. Copy the whole folder (SKILL.md and every file beside it), keep the folder name "sequence", then confirm the skill loads.

Codex copies the folder itself, the same result as the manual copy. Check what it changed before you commit it.

skills CLI

$ npx skills add lamm-mit/scienceclaw --skill sequence -a cursor

Project install goes to .agents/skills/; add -g for ~/.cursor/skills/.

GitHub CLI

$ gh skill install lamm-mit/scienceclaw sequence --agent cursor

Project scope by default (.agents/skills/); add --scope user for a personal install.

Manual copy

$ git clone --depth 1 https://github.com/lamm-mit/scienceclaw.git skills-src && mkdir -p .cursor/skills && cp -r skills-src/skills/sequence .cursor/skills/sequence && rm -rf skills-src

Use ~/.cursor/skills/ instead of .cursor/skills for a personal install.

Cursor skills documentation · loads skills from .cursor/skills/, .agents/skills/, .claude/skills/, .codex/skills/

Paste into Cursor

Install the "sequence" agent skill from https://github.com/lamm-mit/scienceclaw/tree/main/skills/sequence into .cursor/skills/sequence/ in this project. Copy the whole folder (SKILL.md and every file beside it), keep the folder name "sequence", then confirm the skill loads.

Cursor copies the folder itself, the same result as the manual copy. Check what it changed before you commit it.

gemini skills install

$ gemini skills install https://github.com/lamm-mit/scienceclaw.git --path skills/sequence

--scope user (default) or --scope workspace; --path is the subfolder of the repo that holds the skill; --consent skips the security confirmation prompt.

skills CLI

$ npx skills add lamm-mit/scienceclaw --skill sequence -a gemini-cli

Project install goes to .agents/skills/; add -g for ~/.gemini/skills/.

GitHub CLI

$ gh skill install lamm-mit/scienceclaw sequence --agent gemini-cli

Project scope by default (.agents/skills/); add --scope user for a personal install.

Manual copy

$ git clone --depth 1 https://github.com/lamm-mit/scienceclaw.git skills-src && mkdir -p .gemini/skills && cp -r skills-src/skills/sequence .gemini/skills/sequence && rm -rf skills-src

Use ~/.gemini/skills/ instead of .gemini/skills for a personal install, then run /skills reload.

Gemini CLI skills documentation · loads skills from .gemini/skills/, .agents/skills/

Paste into Gemini CLI

Install the "sequence" agent skill from https://github.com/lamm-mit/scienceclaw/tree/main/skills/sequence into .gemini/skills/sequence/ in this project. Copy the whole folder (SKILL.md and every file beside it), keep the folder name "sequence", then confirm the skill loads.

Gemini CLI copies the folder itself, the same result as the manual copy. Check what it changed before you commit it.

GitHub CLI

$ gh skill install lamm-mit/scienceclaw sequence

Installs for Copilot at project scope by default; add --scope user for a personal install. Preview a skill first with gh skill preview. Needs GitHub CLI 2.90.0 or later (public preview).

skills CLI

$ npx skills add lamm-mit/scienceclaw --skill sequence -a github-copilot

Project install goes to .agents/skills/; add -g for ~/.copilot/skills/.

Manual copy

$ git clone --depth 1 https://github.com/lamm-mit/scienceclaw.git skills-src && mkdir -p .github/skills && cp -r skills-src/skills/sequence .github/skills/sequence && rm -rf skills-src

Use ~/.copilot/skills/ instead of .github/skills for a personal install. Commit .github/skills so cloud agent and code review can use it.

GitHub Copilot skills documentation · loads skills from .github/skills/, .claude/skills/, .agents/skills/

Paste into GitHub Copilot

Install the "sequence" agent skill from https://github.com/lamm-mit/scienceclaw/tree/main/skills/sequence into .github/skills/sequence/ in this project. Copy the whole folder (SKILL.md and every file beside it), keep the folder name "sequence", then confirm the skill loads.

GitHub Copilot copies the folder itself, the same result as the manual copy. Check what it changed before you commit it.

skills CLI

$ npx skills add lamm-mit/scienceclaw --skill sequence -a opencode

OpenCode documents no install command of its own. Project install goes to .agents/skills/; add -g for ~/.config/opencode/skills/.

GitHub CLI

$ gh skill install lamm-mit/scienceclaw sequence --agent opencode

Project scope by default (.agents/skills/); add --scope user for a personal install.

Manual copy

$ git clone --depth 1 https://github.com/lamm-mit/scienceclaw.git skills-src && mkdir -p .opencode/skills && cp -r skills-src/skills/sequence .opencode/skills/sequence && rm -rf skills-src

Use ~/.config/opencode/skills/ instead of .opencode/skills for a personal install.

OpenCode skills documentation · loads skills from .opencode/skills/, .claude/skills/, .agents/skills/

Paste into OpenCode

Install the "sequence" agent skill from https://github.com/lamm-mit/scienceclaw/tree/main/skills/sequence into .opencode/skills/sequence/ in this project. Copy the whole folder (SKILL.md and every file beside it), keep the folder name "sequence", then confirm the skill loads.

OpenCode copies the folder itself, the same result as the manual copy. Check what it changed before you commit it.

Facts

Skill name: sequence
GitHub stars: 244
Token cost: ~1.1k tokens
SKILL.md length: 351 words
Files: 3 (incl. scripts)
Skills in repo: 85
Repo updated: Aug 21, 2026
First seen: Oct 7, 2026
Licence: Apache-2.0

At a glance

Analyze biological sequences using Biopython - translate, align, parse FASTA/GenBank

Tasks that involve Bioinformatics
SKILL.md covers Overview, Usage, Commands and Examples, plus 3 more sections
Runs Python scripts from its folder; calls python3

What it does

Sequence is an agent skill from lamm-mit/scienceclaw. Analyze biological sequences using Biopython - translate, align, parse FASTA/GenBank

Its SKILL.md is about 1.1k tokens, which your agent loads only when the skill is triggered. The skill folder holds 4 other files, including scripts (for example `scripts/sequence_tools.py`).

It sits in Research & Science, covering Bioinformatics. It works with NCBI and Biopython. The licence is Apache-2.0.

When your agent uses it

Tasks that involve Bioinformatics

Example prompts

“/sequence”

Requirements

Python 3

What it can do on your machine

Read from SKILL.md and the folder at commit ab9aba1. It shows what the files ask for, not the result of running them.

Tool permissions
Pre-approves nothing: there is no allowed-tools line, so your agent's usual permission prompts apply.
From allowed-tools in the SKILL.md frontmatter.
Runs code
Ships 2 files in scripts/ (Python), which the agent can run.
Shell commands in SKILL.md call:
- python3
From the folder's file list and the shell code blocks in SKILL.md.
Network
No URLs in SKILL.md.
From URLs in SKILL.md, links to its own repository left out.
Credentials
Names no API keys, tokens, secrets or passwords.
From names ending in _API_KEY, _TOKEN, _SECRET, _KEY or _PASSWORD in SKILL.md.

Context cost

Sequence loads about 1.1k tokens when it runs. Until then it costs about 23 tokens; SKILL.md has 351 words of instructions outside code blocks.

Always · name and description, kept in context so the agent knows when to use it: ~23
When it runs · the whole SKILL.md, loaded when a task matches: ~1.1k

Estimates: characters ÷ 4, the usual rule of thumb; real counts depend on the model's tokenizer. Scripts and assets cost tokens only if the agent reads them.

Safety

Auto-check passed

The automated check found no risky patterns in SKILL.md.

Automated static check — not a guarantee. Review scripts before installing. It scans the text of SKILL.md for risky patterns (piping downloads into a shell, reading credential files, hidden Unicode, destructive commands); the scripts in this folder are not scanned.

SKILL.md

The full file from lamm-mit/scienceclaw at commit ab9aba1, republished under its Apache-2.0 licence (© lamm-mit). 351 words, ~1,104 tokens.

Download SKILL.mdSave it as .claude/skills/sequence/SKILL.md (or your agent's skills folder). This skill also uses 2 other files; get the full folder from GitHub.

name: sequence
description: Analyze biological sequences using Biopython - translate, align, parse FASTA/GenBank

Sequence Analysis

Analyze biological sequences using Biopython. Translate DNA, compute statistics, parse sequence files, and perform basic alignments.

Overview

This skill provides sequence analysis capabilities including:

DNA/RNA translation to protein
Sequence statistics (GC content, molecular weight, etc.)
Reverse complement
FASTA/GenBank file parsing
Sequence alignment
Motif searching

Usage

Translate DNA to protein:

bash

python3 {baseDir}/scripts/sequence_tools.py translate --sequence "ATGCGATCGATCGATCG"

Compute sequence statistics:

bash

python3 {baseDir}/scripts/sequence_tools.py stats --sequence "ATGCGATCGATCGATCG"

Get reverse complement:

bash

python3 {baseDir}/scripts/sequence_tools.py revcomp --sequence "ATGCGATCGATCG"

Parse FASTA file:

bash

python3 {baseDir}/scripts/sequence_tools.py parse --file sequences.fasta --format fasta

Find ORFs:

bash

python3 {baseDir}/scripts/sequence_tools.py orfs --sequence "ATGCGATCGATCGATCGTAG"

Search for motif:

bash

python3 {baseDir}/scripts/sequence_tools.py motif --sequence "ATGCGATCGATCG" --pattern "GATC"

Commands

translate

Translate DNA/RNA sequence to protein.

Parameter	Description	Default
`--sequence`	DNA/RNA sequence or file	Required
`--table`	Codon table (1=standard, 2=mitochondrial, etc.)	1
`--frame`	Reading frame (1, 2, 3, -1, -2, -3)	1
`--all-frames`	Translate all 6 reading frames	False
`--to-stop`	Translate until first stop codon	False

stats

Compute sequence statistics.

Parameter	Description	Default
`--sequence`	Sequence or file	Required
`--type`	Sequence type: dna, rna, protein, auto	auto

Output includes:

Length
GC content (nucleotide)
Molecular weight
Base/amino acid composition

revcomp

Get reverse complement of DNA sequence.

Parameter	Description
`--sequence`	DNA sequence or file

parse

Parse sequence files (FASTA, GenBank, etc.).

Parameter	Description	Default
`--file`	Input file path	Required
`--format`	File format: fasta, genbank, embl	auto
`--output`	Output format: summary, fasta, json	summary

orfs

Find Open Reading Frames.

Parameter	Description	Default
`--sequence`	DNA sequence or file	Required
`--min-length`	Minimum ORF length (codons)	30
`--table`	Codon table	1

Show full SKILL.md (141 more words)Show less

motif

Search for sequence motifs/patterns.

Parameter	Description	Default
`--sequence`	Sequence to search	Required
`--pattern`	Pattern to find (supports IUPAC codes)	Required

Examples

Translate with specific codon table:

bash

python3 {baseDir}/scripts/sequence_tools.py translate --sequence "ATGCGATCG" --table 2

Get stats for protein sequence:

bash

python3 {baseDir}/scripts/sequence_tools.py stats --sequence "MTEYKLVVVGAGGVGKSALTIQLIQ" --type protein

Parse GenBank file and extract sequences:

bash

python3 {baseDir}/scripts/sequence_tools.py parse --file gene.gb --format genbank --output fasta

Find all ORFs with minimum 50 codons:

bash

python3 {baseDir}/scripts/sequence_tools.py orfs --file genome.fasta --min-length 50

Translate all 6 reading frames:

bash

python3 {baseDir}/scripts/sequence_tools.py translate --sequence "ATGCGATCGATCGATCG" --all-frames

Codon Tables

ID	Description
1	Standard
2	Vertebrate Mitochondrial
3	Yeast Mitochondrial
4	Mold/Protozoan Mitochondrial
5	Invertebrate Mitochondrial
6	Ciliate Nuclear
11	Bacterial/Archaeal/Plant Plastid

IUPAC Codes

Nucleotides

R = A or G (purine)
Y = C or T (pyrimidine)
S = G or C
W = A or T
K = G or T
M = A or C
N = any nucleotide

Amino Acids

X = any amino acid
B = D or N
Z = E or Q

Notes

Sequences can be provided directly or as file paths
Auto-detection identifies DNA/RNA/protein sequences
Large files are processed efficiently with streaming

Files

SKILL.md and 2 other files (scripts) in skills/sequence of lamm-mit/scienceclaw.

SKILL.md
scripts/__pycache__/sequence_tools.cpython-313.pyc
scripts/sequence_tools.py

Open the folder on GitHubat commit ab9aba1

Compare with similar skills

Sequence next to the 5 skills that share the most tags, products or categories with it. Stars are the repository's; “used in” counts other GitHub owners with a copy.

Sequence compared with similar skills
Skill	Stars	Used in	Tokens	Auto-check	Licence	Repo updated
Sequence this skilllamm-mit/scienceclaw	244	—	~1.1k	Automated safety check: Pass	Apache-2.0	1 mo ago
Biopython Bioinformaticsaiming-lab/AutoResearchClaw	15k	—	~810	Automated safety check: Pass	MIT	1 mo ago
Bio Write SequencesGPTomics/bioSkills	1.2k	3 repos	~2.1k	Automated safety check: Pass	MIT	1 mo ago
Biopythondavila7/claude-code-templates	32k	13 repos	~3.4k	Automated safety check: Pass	MIT	today
BiopythonK-Dense-AI/scientific-agent-skills	48k	1 repos	~4.3k	Automated safety check: Notes	MIT	2 days ago
Tooluniverse Phylogeneticswu-yc/LabClaw	1.1k	2 repos	~4.2k	Automated safety check: Pass	None	6 mo ago

Similar skills

Biopython Bioinformatics
aiming-lab/AutoResearchClaw
Quick reference for Biopython work: sequence operations, SeqIO file parsing, BLAST searches, Entrez queries, phylogenetic trees and PDB structure analysis.
15k GitHub stars~810 tokensUpdated 1 mo ago
Research & ScienceAuto-check passed
Bio Write Sequences
GPTomics/bioSkills
Write biological sequences to files (FASTA, FASTQ, GenBank, EMBL) using Biopython Bio.SeqIO.
1.2k GitHub starsUsed in 3 repos~2.1k tokens
Research & ScienceAuto-check passed
Biopython
davila7/claude-code-templates
Primary Python toolkit for molecular biology. An agent skill from davila7/claude-code-templates.
32k GitHub starsUsed in 13 repos~3.4k tokens
Research & ScienceAuto-check passed
Biopython
K-Dense-AI/scientific-agent-skills
Provides Biopython workflows for sequence manipulation, file parsing (FASTA/GenBank/PDB), phylogenetics, and programmatic NCBI/PubMed access (Bio.Entrez).
48k GitHub starsUsed in 1 repo~4.3k tokens
Research & ScienceAuto-check: notes
Tooluniverse Phylogenetics
wu-yc/LabClaw
Production-ready phylogenetics and sequence analysis skill for alignment processing, tree analysis, and evolutionary metrics.
1.1k GitHub starsUsed in 2 repos~4.2k tokens
Research & ScienceAuto-check passed
Bio Blast Searches
GPTomics/bioSkills
Run remote BLAST searches against NCBI servers using Biopython Bio.Blast.NCBIWWW.
1.2k GitHub starsUsed in 2 repos~3.9k tokens
Research & ScienceAuto-check passed

Questions about Sequence

What does Sequence do?

Analyze biological sequences using Biopython - translate, align, parse FASTA/GenBank. Sequence is an agent skill from lamm-mit/scienceclaw.

When should I use Sequence?

Sequence fits situations like: tasks that involve Bioinformatics.

How do I install Sequence in Claude Code?

Run `npx skills add lamm-mit/scienceclaw --skill sequence -a claude-code`. Or copy the skill folder (skills/sequence in lamm-mit/scienceclaw) into .claude/skills/sequence in your project. Claude Code loads it when a task matches its description.

How do I install Sequence in Codex?

Run `npx skills add lamm-mit/scienceclaw --skill sequence -a codex`. Or copy the skill folder (skills/sequence in lamm-mit/scienceclaw) into .agents/skills/sequence in your project. Codex loads it when a task matches its description.

Can I use Sequence in Cursor, Gemini CLI or GitHub Copilot?

Cursor, Gemini CLI, GitHub Copilot and OpenCode also load SKILL.md folders. With the skills CLI, run `npx skills add lamm-mit/scienceclaw --skill sequence -a cursor` (or -a gemini-cli, github-copilot or opencode for the others). To copy it by hand, put the folder in .cursor/skills/sequence, .gemini/skills/sequence, .github/skills/sequence and .opencode/skills/sequence in your project.

What does Sequence need to run?

Going by SKILL.md and its folder, Sequence needs Python for the scripts in its folder and the command-line tools its instructions call (python3). Our summary lists: Python 3.

Does Sequence access the network?

SKILL.md contains no URLs. Any network use would come from the scripts or tools the agent runs. This is read from the text; nothing was executed.

Is Sequence safe to install?

Our automated static check of SKILL.md found no risky patterns, such as piping downloads into a shell, reading credential files or hidden Unicode. It is not a guarantee. The check reads SKILL.md only: the scripts in the folder are not scanned, so read them before running anything.

What licence does Sequence use?

Sequence is published under the Apache-2.0 licence (the repository's licence). It allows redistribution, so the full SKILL.md is shown on this page.

How many tokens does Sequence use?

About 1.1k tokens (SKILL.md is roughly 4.4k characters). Agents keep only the skill's name and description in context until a task matches; then they load SKILL.md in full.

What are the alternatives to Sequence?

Skills that share tags, products or a category with Sequence: Biopython Bioinformatics (aiming-lab/AutoResearchClaw, 15k stars), Bio Write Sequences (GPTomics/bioSkills, 1.2k stars), Biopython (davila7/claude-code-templates, 32k stars) and Biopython (K-Dense-AI/scientific-agent-skills, 48k stars). The comparison table on this page puts their stars, adoption, token cost, safety result and licence side by side.

Who maintains Sequence?

lamm-mit (a GitHub user) maintains it in lamm-mit/scienceclaw, which has 244 GitHub stars. The repository holds 85 skills in this directory. The repository was last updated on August 21, 2026.

Source: lamm-mit/scienceclaw on GitHub. Facts on this page come from the repository at the commit we read; the author's words are quoted as theirs.

Install Sequence

Facts

At a glance

What it does

When your agent uses it

Example prompts

Requirements

What it can do on your machine

Tool permissions

Runs code

Network

Credentials

Context cost

Safety

SKILL.md

Sequence Analysis

Overview

Usage

Translate DNA to protein:

Compute sequence statistics:

Get reverse complement:

Parse FASTA file:

Find ORFs:

Search for motif:

Commands

translate

stats

revcomp

parse

orfs

motif

Examples

Translate with specific codon table:

Get stats for protein sequence:

Parse GenBank file and extract sequences:

Find all ORFs with minimum 50 codons:

Translate all 6 reading frames:

Codon Tables

IUPAC Codes

Nucleotides

Amino Acids

Notes

Files

Compare with similar skills

Similar skills

More from lamm-mit/scienceclaw

Related

Questions about Sequence