Dbsnp Database
google-deepmind/science-skills
A skill your agent uses when you want to look up, map, and search for short genetic variants (SNPs, indels) in NCBI's dbSNP database.
ToolUniverse workflow — Sequence Retrieval. An agent skill from lamm-mit/scienceclaw.
Install Sequence Retrieval
$ npx skills add lamm-mit/scienceclaw --skill sequence-retrieval -a claude-codeProject install by default; add -g for ~/.claude/skills/.
$ gh skill install lamm-mit/scienceclaw sequence-retrieval --agent claude-codeProject scope by default; add --scope user for a personal install. Needs GitHub CLI 2.90.0 or later (public preview).
$ git clone --depth 1 https://github.com/lamm-mit/scienceclaw.git skills-src && mkdir -p .claude/skills && cp -r skills-src/skills/sequence-retrieval .claude/skills/sequence-retrieval && rm -rf skills-srcUse ~/.claude/skills/ instead of .claude/skills for a personal install. The folder must contain SKILL.md.
Claude Code skills documentation · loads skills from .claude/skills/
Install the "sequence-retrieval" agent skill from https://github.com/lamm-mit/scienceclaw/tree/main/skills/sequence-retrieval into .claude/skills/sequence-retrieval/ in this project. Copy the whole folder (SKILL.md and every file beside it), keep the folder name "sequence-retrieval", then confirm the skill loads.Claude Code copies the folder itself, the same result as the manual copy. Check what it changed before you commit it.
$skill-installer install https://github.com/lamm-mit/scienceclaw/tree/main/skills/sequence-retrievalType this inside Codex. $skill-installer <name> installs a curated skill from openai/skills. The installer writes to $CODEX_HOME/skills (default ~/.codex/skills). Restart Codex if the skill does not show up.
$ npx skills add lamm-mit/scienceclaw --skill sequence-retrieval -a codexProject install goes to .agents/skills/; add -g for ~/.codex/skills/.
$ gh skill install lamm-mit/scienceclaw sequence-retrieval --agent codexProject scope by default (.agents/skills/); add --scope user for a personal install.
$ git clone --depth 1 https://github.com/lamm-mit/scienceclaw.git skills-src && mkdir -p .agents/skills && cp -r skills-src/skills/sequence-retrieval .agents/skills/sequence-retrieval && rm -rf skills-srcUse ~/.agents/skills/ instead of .agents/skills for a personal install.
Codex skills documentation · loads skills from .agents/skills/
Install the "sequence-retrieval" agent skill from https://github.com/lamm-mit/scienceclaw/tree/main/skills/sequence-retrieval into .agents/skills/sequence-retrieval/ in this project. Copy the whole folder (SKILL.md and every file beside it), keep the folder name "sequence-retrieval", then confirm the skill loads.Codex copies the folder itself, the same result as the manual copy. Check what it changed before you commit it.
$ npx skills add lamm-mit/scienceclaw --skill sequence-retrieval -a cursorProject install goes to .agents/skills/; add -g for ~/.cursor/skills/.
$ gh skill install lamm-mit/scienceclaw sequence-retrieval --agent cursorProject scope by default (.agents/skills/); add --scope user for a personal install.
$ git clone --depth 1 https://github.com/lamm-mit/scienceclaw.git skills-src && mkdir -p .cursor/skills && cp -r skills-src/skills/sequence-retrieval .cursor/skills/sequence-retrieval && rm -rf skills-srcUse ~/.cursor/skills/ instead of .cursor/skills for a personal install.
Cursor skills documentation · loads skills from .cursor/skills/, .agents/skills/, .claude/skills/, .codex/skills/
Install the "sequence-retrieval" agent skill from https://github.com/lamm-mit/scienceclaw/tree/main/skills/sequence-retrieval into .cursor/skills/sequence-retrieval/ in this project. Copy the whole folder (SKILL.md and every file beside it), keep the folder name "sequence-retrieval", then confirm the skill loads.Cursor copies the folder itself, the same result as the manual copy. Check what it changed before you commit it.
$ gemini skills install https://github.com/lamm-mit/scienceclaw.git --path skills/sequence-retrieval--scope user (default) or --scope workspace; --path is the subfolder of the repo that holds the skill; --consent skips the security confirmation prompt.
$ npx skills add lamm-mit/scienceclaw --skill sequence-retrieval -a gemini-cliProject install goes to .agents/skills/; add -g for ~/.gemini/skills/.
$ gh skill install lamm-mit/scienceclaw sequence-retrieval --agent gemini-cliProject scope by default (.agents/skills/); add --scope user for a personal install.
$ git clone --depth 1 https://github.com/lamm-mit/scienceclaw.git skills-src && mkdir -p .gemini/skills && cp -r skills-src/skills/sequence-retrieval .gemini/skills/sequence-retrieval && rm -rf skills-srcUse ~/.gemini/skills/ instead of .gemini/skills for a personal install, then run /skills reload.
Gemini CLI skills documentation · loads skills from .gemini/skills/, .agents/skills/
Install the "sequence-retrieval" agent skill from https://github.com/lamm-mit/scienceclaw/tree/main/skills/sequence-retrieval into .gemini/skills/sequence-retrieval/ in this project. Copy the whole folder (SKILL.md and every file beside it), keep the folder name "sequence-retrieval", then confirm the skill loads.Gemini CLI copies the folder itself, the same result as the manual copy. Check what it changed before you commit it.
$ gh skill install lamm-mit/scienceclaw sequence-retrievalInstalls for Copilot at project scope by default; add --scope user for a personal install. Preview a skill first with gh skill preview. Needs GitHub CLI 2.90.0 or later (public preview).
$ npx skills add lamm-mit/scienceclaw --skill sequence-retrieval -a github-copilotProject install goes to .agents/skills/; add -g for ~/.copilot/skills/.
$ git clone --depth 1 https://github.com/lamm-mit/scienceclaw.git skills-src && mkdir -p .github/skills && cp -r skills-src/skills/sequence-retrieval .github/skills/sequence-retrieval && rm -rf skills-srcUse ~/.copilot/skills/ instead of .github/skills for a personal install. Commit .github/skills so cloud agent and code review can use it.
GitHub Copilot skills documentation · loads skills from .github/skills/, .claude/skills/, .agents/skills/
Install the "sequence-retrieval" agent skill from https://github.com/lamm-mit/scienceclaw/tree/main/skills/sequence-retrieval into .github/skills/sequence-retrieval/ in this project. Copy the whole folder (SKILL.md and every file beside it), keep the folder name "sequence-retrieval", then confirm the skill loads.GitHub Copilot copies the folder itself, the same result as the manual copy. Check what it changed before you commit it.
$ npx skills add lamm-mit/scienceclaw --skill sequence-retrieval -a opencodeOpenCode documents no install command of its own. Project install goes to .agents/skills/; add -g for ~/.config/opencode/skills/.
$ gh skill install lamm-mit/scienceclaw sequence-retrieval --agent opencodeProject scope by default (.agents/skills/); add --scope user for a personal install.
$ git clone --depth 1 https://github.com/lamm-mit/scienceclaw.git skills-src && mkdir -p .opencode/skills && cp -r skills-src/skills/sequence-retrieval .opencode/skills/sequence-retrieval && rm -rf skills-srcUse ~/.config/opencode/skills/ instead of .opencode/skills for a personal install.
OpenCode skills documentation · loads skills from .opencode/skills/, .claude/skills/, .agents/skills/
Install the "sequence-retrieval" agent skill from https://github.com/lamm-mit/scienceclaw/tree/main/skills/sequence-retrieval into .opencode/skills/sequence-retrieval/ in this project. Copy the whole folder (SKILL.md and every file beside it), keep the folder name "sequence-retrieval", then confirm the skill loads.OpenCode copies the folder itself, the same result as the manual copy. Check what it changed before you commit it.
Facts
- Skill name
sequence-retrieval- GitHub stars
- 244
- Token cost
- ~2.8k tokens
- SKILL.md length
- 724 words
- Files
- 3 (incl. scripts)
- Skills in repo
- 85
- Repo updated
- First seen
- Licence
- Apache-2.0
At a glance
ToolUniverse workflow — Sequence Retrieval. An agent skill from lamm-mit/scienceclaw.
- Works in 4 steps: Clarification (When Needed) → Gene/Organism Disambiguation → Data Retrieval (Internal) → …
- Research & Science work in your project
- SKILL.md covers Workflow Overview, Phase 0: Clarification (When…, Phase 1: Gene/Organism… and Phase 2: Data Retrieval…, plus 7 more sections
- Runs Python scripts from its folder
What it does
Sequence Retrieval is an agent skill from lamm-mit/scienceclaw. ToolUniverse workflow — Sequence Retrieval
Its SKILL.md is about 2.8k tokens, which your agent loads only when the skill is triggered. The skill folder holds 4 other files, including scripts (for example `scripts/run.py`).
It sits in Research & Science. It works with NCBI. The licence is Apache-2.0.
When your agent uses it
- Research & Science work in your project
Example prompts
- “/sequence-retrieval”
Requirements
- Python 3
Workflow steps
4 steps, taken from the step headings in SKILL.md.
What it can do on your machine
Read from SKILL.md and the folder at commit ab9aba1. It shows what the files ask for, not the result of running them.
Tool permissions
Pre-approves nothing: there is no allowed-tools line, so your agent's usual permission prompts apply.
From allowed-tools in the SKILL.md frontmatter.
Runs code
Ships 2 files in scripts/ (Python), which the agent can run.
From the folder's file list and the shell code blocks in SKILL.md.
Network
No URLs in SKILL.md.
From URLs in SKILL.md, links to its own repository left out.
Credentials
Names no API keys, tokens, secrets or passwords.
From names ending in _API_KEY, _TOKEN, _SECRET, _KEY or _PASSWORD in SKILL.md.
Context cost
Sequence Retrieval loads about 2.8k tokens when it runs. Until then it costs about 15 tokens; SKILL.md has 724 words of instructions outside code blocks.
Estimates: characters ÷ 4, the usual rule of thumb; real counts depend on the model's tokenizer. Scripts and assets cost tokens only if the agent reads them.
Safety
Auto-check passed
The automated check found no risky patterns in SKILL.md.
Automated static check — not a guarantee. Review scripts before installing. It scans the text of SKILL.md for risky patterns (piping downloads into a shell, reading credential files, hidden Unicode, destructive commands); the scripts in this folder are not scanned.
SKILL.md
The full file from lamm-mit/scienceclaw at commit ab9aba1, republished under its Apache-2.0 licence (© lamm-mit). 724 words, ~2,791 tokens.
Download SKILL.mdSave it as
.claude/skills/sequence-retrieval/SKILL.md (or your agent's skills folder). This skill also uses 2 other files; get the full folder from GitHub.- name
- sequence-retrieval
- description
- ToolUniverse workflow — Sequence Retrieval
- source
- https://github.com/mims-harvard/ToolUniverse/tree/main/skills/tooluniverse-sequence-retrieval
name: tooluniverse-sequence-retrieval description: Retrieves biological sequences (DNA, RNA, protein) from NCBI and ENA with gene disambiguation, accession type handling, and comprehensive sequence profiles. Creates detailed reports with sequence metadata, cross-database references, and download options. Use when users need nucleotide sequences, protein sequences, genome data, or mention GenBank, RefSeq, EMBL accessions.
Biological Sequence Retrieval
Retrieve DNA, RNA, and protein sequences with proper disambiguation and cross-database handling.
IMPORTANT: Always use English terms in tool calls (gene names, organism names, sequence descriptions), even if the user writes in another language. Only try original-language terms as a fallback if English returns no results. Respond in the user's language.
Workflow Overview
Phase 0: Clarify (if needed)
↓
Phase 1: Disambiguate Gene/Organism
↓
Phase 2: Search & Retrieve (Internal)
↓
Phase 3: Report Sequence ProfilePhase 0: Clarification (When Needed)
Ask the user ONLY if:
- Gene name exists in multiple organisms (e.g., "BRCA1" → human or mouse?)
- Sequence type unclear (mRNA, genomic, protein?)
- Strain/isolate matters (e.g., E. coli → K-12, O157:H7, etc.)
Skip clarification for:
- Specific accession numbers (NC_*, NM_*, U*, etc.)
- Clear organism + gene combinations
- Complete genome requests with organism specified
Phase 1: Gene/Organism Disambiguation
1.1 Resolve Identifiers
from tooluniverse import ToolUniverse
tu = ToolUniverse()
tu.load_tools()
# Strategy depends on input type
if user_provided_accession:
# Direct retrieval based on accession type
accession = user_provided_accession
elif user_provided_gene_and_organism:
# Search NCBI Nucleotide
result = tu.tools.NCBI_search_nucleotide(
operation="search",
organism=organism,
gene=gene,
limit=10
)1.2 Accession Type Decision Tree
CRITICAL: Accession prefix determines which tools to use.
| Prefix | Type | Use With |
|---|---|---|
| NC_* | RefSeq chromosome | NCBI only |
| NM_* | RefSeq mRNA | NCBI only |
| NR_* | RefSeq ncRNA | NCBI only |
| NP_* | RefSeq protein | NCBI only |
| XM_* | RefSeq predicted mRNA | NCBI only |
| U*, M*, K*, X* | GenBank | NCBI or ENA |
| CP*, NZ_* | GenBank genome | NCBI or ENA |
| EMBL format | EMBL | ENA preferred |
1.3 Identity Resolution Checklist
- Organism confirmed (scientific name)
- Gene symbol/name identified
- Sequence type determined (genomic/mRNA/protein)
- Strain specified (if relevant)
- Accession prefix identified → tool selection
Phase 2: Data Retrieval (Internal)
Retrieve silently. Do NOT narrate the search process.
2.1 Search for Sequences
# Search NCBI Nucleotide
result = tu.tools.NCBI_search_nucleotide(
operation="search",
organism=organism,
gene=gene,
strain=strain, # Optional
keywords=keywords, # Optional
seq_type=seq_type, # complete_genome, mrna, refseq
limit=10
)
# Get accession numbers from UIDs
accessions = tu.tools.NCBI_fetch_accessions(
operation="fetch_accession",
uids=result["data"]["uids"]
)2.2 Retrieve Sequence Data
# Get sequence in desired format
sequence = tu.tools.NCBI_get_sequence(
operation="fetch_sequence",
accession=accession,
format="fasta" # or "genbank"
)
# GenBank format for annotations
annotations = tu.tools.NCBI_get_sequence(
operation="fetch_sequence",
accession=accession,
format="genbank"
)2.3 ENA Alternative (for GenBank/EMBL accessions)
# Only for non-RefSeq accessions!
if not accession.startswith(("NC_", "NM_", "NR_", "NP_", "XM_", "XR_")):
# ENA entry info
entry = tu.tools.ena_get_entry(accession=accession)
# ENA FASTA
fasta = tu.tools.ena_get_sequence_fasta(accession=accession)
# ENA summary
summary = tu.tools.ena_get_entry_summary(accession=accession)Fallback Chains
| Primary | Fallback | Notes |
|---|---|---|
| NCBI_get_sequence | ENA (if GenBank format) | NCBI unavailable |
| ENA_get_entry | NCBI_get_sequence | ENA doesn't have RefSeq |
| NCBI_search_nucleotide | Try broader keywords | No results |
Critical Rule: Never try ENA tools with RefSeq accessions (NC_, NM_, etc.) - they will return 404 errors.
Phase 3: Report Sequence Profile
Output Structure
Present as a Sequence Profile Report. Hide search process.
# Sequence Profile: [Gene/Organism]
**Search Summary**
- Query: [gene] in [organism]
- Database: NCBI Nucleotide
- Results: [N] sequences found
---
## Primary Sequence
### [Accession]: [Definition/Title]
| Attribute | Value |
|-----------|-------|
| **Accession** | [accession] |
| **Type** | RefSeq / GenBank |
| **Organism** | [scientific name] |
| **Strain** | [strain if applicable] |
| **Length** | [X,XXX bp / aa] |
| **Molecule** | DNA / mRNA / Protein |
| **Topology** | Linear / Circular |
**Curation Level**: ●●● RefSeq (curated) / ●●○ GenBank (submitted) / ●○○ Third-party
### Sequence Statistics
| Statistic | Value |
|-----------|-------|
| **Length** | [X,XXX] bp |
| **GC Content** | [XX.X]% |
| **Genes** | [N] (if genome) |
| **CDS** | [N] (if annotated) |
### Sequence Preview
```fasta
>[accession] [definition]
ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA
... [truncated, full sequence in download]Annotations Summary (from GenBank format)
| Feature | Count | Examples |
|---|---|---|
| CDS | [N] | [gene names] |
| tRNA | [N] | - |
| rRNA | [N] | 16S, 23S |
| Regulatory | [N] | promoters |
Alternative Sequences
Ranked by relevance and curation level:
| Accession | Type | Length | Description | ENA Compatible |
|---|---|---|---|---|
| NC_000913.3 | RefSeq | 4.6 Mb | E. coli K-12 reference | ✗ |
| U00096.3 | GenBank | 4.6 Mb | E. coli K-12 | ✓ |
| CP001509.3 | GenBank | 4.6 Mb | E. coli DH10B | ✓ |
Cross-Database References
| Database | Accession | Link |
|---|---|---|
| RefSeq | [NC_*] | [NCBI link] |
| GenBank | [U*] | [NCBI link] |
| ENA/EMBL | [same as GenBank] | [ENA link] |
| BioProject | [PRJNA*] | [link] |
| BioSample | [SAMN*] | [link] |
Download Options
Formats Available
| Format | Description | Use Case |
|---|---|---|
| FASTA | Sequence only | BLAST, alignment |
| GenBank | Sequence + annotations | Gene analysis |
| GFF3 | Annotations only | Genome browsers |
Show full SKILL.md (280 more words)Show less
Direct Commands
# FASTA format
tu.tools.NCBI_get_sequence(
operation="fetch_sequence",
accession="[accession]",
format="fasta"
)
# GenBank format (with annotations)
tu.tools.NCBI_get_sequence(
operation="fetch_sequence",
accession="[accession]",
format="genbank"
)Related Sequences
Other Strains/Isolates
| Accession | Strain | Similarity | Notes |
|---|---|---|---|
| [acc1] | [strain1] | 99.9% | [notes] |
| [acc2] | [strain2] | 99.5% | [notes] |
Protein Products (if applicable)
| Protein Accession | Product Name | Length |
|---|---|---|
| [NP_*] | [protein name] | [X] aa |
Retrieved: [date] Database: NCBI Nucleotide
---
## Curation Level Tiers
| Tier | Symbol | Accession Prefix | Description |
|------|--------|------------------|-------------|
| RefSeq Reference | ●●●● | NC_, NM_, NP_ | NCBI-curated, gold standard |
| RefSeq Predicted | ●●●○ | XM_, XP_, XR_ | Computationally predicted |
| GenBank Validated | ●●○○ | Various | Submitted, some curation |
| GenBank Direct | ●○○○ | Various | Direct submission |
| Third Party | ○○○○ | TPA_ | Third-party annotation |
Include in report:
```markdown
**Curation Level**: ●●●● RefSeq Reference
- Curated by NCBI RefSeq project
- Regular updates and validation
- Recommended for reference useCompleteness Checklist
Every sequence report MUST include:
Per Sequence (Required)
- Accession number
- Organism (scientific name)
- Sequence type (DNA/RNA/protein)
- Length
- Curation level
- Database source
Search Summary (Required)
- Query parameters
- Number of results
- Ranking rationale
Include Even If Limited
- Alternative sequences (or "Only one sequence found")
- Cross-database references (or "No cross-references available")
- Download instructions
Common Use Cases
Reference Genome
User: "Get E. coli K-12 complete genome"
result = tu.tools.NCBI_search_nucleotide(
operation="search",
organism="Escherichia coli",
strain="K-12",
seq_type="complete_genome",
limit=3
)
# Return NC_000913.3 (RefSeq reference)Gene Sequence
User: "Find human BRCA1 mRNA"
result = tu.tools.NCBI_search_nucleotide(
operation="search",
organism="Homo sapiens",
gene="BRCA1",
seq_type="mrna",
limit=10
)Specific Accession
User: "Get sequence for NC_045512.2" → Direct retrieval with full metadata
Strain Comparison
User: "Compare E. coli K-12 and O157:H7 genomes" → Search both strains, provide comparison table
Error Handling
| Error | Response |
|---|---|
| "No search criteria provided" | Add organism, gene, or keywords |
| "ENA 404 error" | Accession is likely RefSeq → use NCBI only |
| "No results found" | Broaden search, check spelling, try synonyms |
| "Sequence too large" | Note size, provide download link instead of preview |
| "API rate limit" | Tools auto-retry; if persistent, wait briefly |
Tool Reference
NCBI Tools (All Accessions)
| Tool | Purpose |
|---|---|
NCBI_search_nucleotide | Search by gene/organism |
NCBI_fetch_accessions | Convert UIDs to accessions |
NCBI_get_sequence | Retrieve sequence data |
ENA Tools (GenBank/EMBL Only)
| Tool | Purpose |
|---|---|
ena_get_entry | Entry metadata |
ena_get_sequence_fasta | FASTA sequence |
ena_get_entry_summary | Summary info |
Search Parameters Reference
NCBI_search_nucleotide
| Parameter | Description | Example |
|---|---|---|
operation | Always "search" | "search" |
organism | Scientific name | "Homo sapiens" |
gene | Gene symbol | "BRCA1" |
strain | Specific strain | "K-12" |
keywords | Free text | "complete genome" |
seq_type | Sequence type | "complete_genome", "mrna", "refseq" |
limit | Max results | 10 |
NCBI_get_sequence
| Parameter | Description | Example |
|---|---|---|
operation | Always "fetch_sequence" | "fetch_sequence" |
accession | Accession number | "NC_000913.3" |
format | Output format | "fasta", "genbank" |
© lamm-mit, Apache-2.0. Rendered from Markdown: HTML in the file is shown as text, images as links, and headings moved down two levels. Raw file
Files
SKILL.md and 2 other files (scripts) in skills/sequence-retrieval of lamm-mit/scienceclaw.
- SKILL.md
- scripts/__pycache__/run.cpython-313.pyc
- scripts/run.py
Open the folder on GitHubat commit ab9aba1
Compare with similar skills
Sequence Retrieval next to the 5 skills that share the most tags, products or categories with it. Stars are the repository's; “used in” counts other GitHub owners with a copy.
| Skill | Stars | Used in | Tokens | Auto-check | Licence | Repo updated |
|---|---|---|---|---|---|---|
| Sequence Retrieval this skilllamm-mit/scienceclaw | 244 | — | ~2.8k | Automated safety check: Pass | Apache-2.0 | |
| Dbsnp Databasegoogle-deepmind/science-skills | 3.2k | 2 repos | ~3.4k | Automated safety check: Notes | Apache-2.0 | |
| Biopython Bioinformaticsaiming-lab/AutoResearchClaw | 15k | — | ~810 | Automated safety check: Pass | MIT | |
| Bio Write SequencesGPTomics/bioSkills | 1.2k | 3 repos | ~2.1k | Automated safety check: Pass | MIT | |
| Mako Loreliebaojun/MakoCode | 155 | — | ~692 | Automated safety check: Pass | Custom licence | |
| PubMed REST API Searchdavila7/claude-code-templates | 32k | 15 repos | ~3.9k | Automated safety check: Pass | MIT |
Similar skills
Biopython Bioinformatics
aiming-lab/AutoResearchClaw
Quick reference for Biopython work: sequence operations, SeqIO file parsing, BLAST searches, Entrez queries, phylogenetic trees and PDB structure analysis.
Bio Write Sequences
GPTomics/bioSkills
Write biological sequences to files (FASTA, FASTQ, GenBank, EMBL) using Biopython Bio.SeqIO.
Mako Lore
liebaojun/MakoCode
穗织世界观、神话与诅咒、身边人物、API速查表——常陆茉子的背景知识库，自动加载. An agent skill from liebaojun/MakoCode.
PubMed REST API Search
davila7/claude-code-templates
Searches PubMed directly through its E-utilities REST API, with guidance on Boolean and MeSH query syntax, batch retrieval and citation data.
ETE Toolkit for Phylogenetic Trees
davila7/claude-code-templates
Guides your agent through building, editing, comparing and drawing phylogenetic trees with the ETE Python toolkit, including orthology calls and NCBI taxonomy lookups.
More from lamm-mit/scienceclaw
All 85 skills in this repoFred Economic Data
lamm-mit/scienceclaw
Query FRED (Federal Reserve Economic Data) API for 800,000+ economic time series from 100+ sources.
Drug Research
lamm-mit/scienceclaw
Generates comprehensive drug research reports with compound disambiguation, evidence grading, and mandatory completeness sections.
Imaging Data Commons
lamm-mit/scienceclaw
Query and download public cancer imaging data from NCI Imaging Data Commons using idc-index.
Rowan
lamm-mit/scienceclaw
Cloud-based quantum chemistry platform with Python API. An agent skill from lamm-mit/scienceclaw.
Infographics
lamm-mit/scienceclaw
Create professional infographics using Nano Banana Pro AI with smart iterative refinement.
Disease Research
lamm-mit/scienceclaw
Generate comprehensive disease research reports using 100+ ToolUniverse tools.
Related
Works with
Categories
Questions about Sequence Retrieval
What does Sequence Retrieval do?
ToolUniverse workflow — Sequence Retrieval. An agent skill from lamm-mit/scienceclaw. Sequence Retrieval is an agent skill from lamm-mit/scienceclaw.
When should I use Sequence Retrieval?
Sequence Retrieval fits situations like: research & Science work in your project.
How do I install Sequence Retrieval in Claude Code?
Run `npx skills add lamm-mit/scienceclaw --skill sequence-retrieval -a claude-code`. Or copy the skill folder (skills/sequence-retrieval in lamm-mit/scienceclaw) into .claude/skills/sequence-retrieval in your project. Claude Code loads it when a task matches its description.
How do I install Sequence Retrieval in Codex?
Run `npx skills add lamm-mit/scienceclaw --skill sequence-retrieval -a codex`. Or copy the skill folder (skills/sequence-retrieval in lamm-mit/scienceclaw) into .agents/skills/sequence-retrieval in your project. Codex loads it when a task matches its description.
Can I use Sequence Retrieval in Cursor, Gemini CLI or GitHub Copilot?
Cursor, Gemini CLI, GitHub Copilot and OpenCode also load SKILL.md folders. With the skills CLI, run `npx skills add lamm-mit/scienceclaw --skill sequence-retrieval -a cursor` (or -a gemini-cli, github-copilot or opencode for the others). To copy it by hand, put the folder in .cursor/skills/sequence-retrieval, .gemini/skills/sequence-retrieval, .github/skills/sequence-retrieval and .opencode/skills/sequence-retrieval in your project.
What does Sequence Retrieval need to run?
Going by SKILL.md and its folder, Sequence Retrieval needs Python for the scripts in its folder. Our summary lists: Python 3.
Does Sequence Retrieval access the network?
SKILL.md contains no URLs. Any network use would come from the scripts or tools the agent runs. This is read from the text; nothing was executed.
Is Sequence Retrieval safe to install?
Our automated static check of SKILL.md found no risky patterns, such as piping downloads into a shell, reading credential files or hidden Unicode. It is not a guarantee. The check reads SKILL.md only: the scripts in the folder are not scanned, so read them before running anything.
What licence does Sequence Retrieval use?
Sequence Retrieval is published under the Apache-2.0 licence (the repository's licence). It allows redistribution, so the full SKILL.md is shown on this page.
How many tokens does Sequence Retrieval use?
About 2.8k tokens (SKILL.md is roughly 11k characters). Agents keep only the skill's name and description in context until a task matches; then they load SKILL.md in full.
What are the alternatives to Sequence Retrieval?
Skills that share tags, products or a category with Sequence Retrieval: Dbsnp Database (google-deepmind/science-skills, 3.2k stars), Biopython Bioinformatics (aiming-lab/AutoResearchClaw, 15k stars), Bio Write Sequences (GPTomics/bioSkills, 1.2k stars) and Mako Lore (liebaojun/MakoCode, 155 stars). The comparison table on this page puts their stars, adoption, token cost, safety result and licence side by side.
Who maintains Sequence Retrieval?
lamm-mit (a GitHub user) maintains it in lamm-mit/scienceclaw, which has 244 GitHub stars. The repository holds 85 skills in this directory. The repository was last updated on August 21, 2026.
Source: lamm-mit/scienceclaw on GitHub. Facts on this page come from the repository at the commit we read; the author's words are quoted as theirs.