New: 98,000+ skills indexed from GitHub repos with 100+ stars · every skill safety-checkedBrowse top skillsTop skills
Esc to closeBrowse all skills
Submit a skillBrowse skills
Submit a skillBrowse skills

Agent skill

Bio Read Qc Adapter Trimming

by GPTomics in GPTomics/bioSkills

Removes sequencing adapters from FASTQ reads with Cutadapt and Trimmomatic, including paired-end read-through, small-RNA 3' adapters, amplicon primers, and anchored/linked adapters.

MITAuto-check passedResearch & Science

Install Bio Read Qc Adapter Trimming

skills CLI
$ npx skills add GPTomics/bioSkills --skill bio-read-qc-adapter-trimming -a claude-code

Project install by default; add -g for ~/.claude/skills/.

GitHub CLI
$ gh skill install GPTomics/bioSkills bio-read-qc-adapter-trimming --agent claude-code

Project scope by default; add --scope user for a personal install. Needs GitHub CLI 2.90.0 or later (public preview).

Manual copy
$ git clone --depth 1 https://github.com/GPTomics/bioSkills.git skills-src && mkdir -p .claude/skills && cp -r skills-src/read-qc/adapter-trimming .claude/skills/bio-read-qc-adapter-trimming && rm -rf skills-src

Use ~/.claude/skills/ instead of .claude/skills for a personal install. The folder must contain SKILL.md.

Claude Code skills documentation · loads skills from .claude/skills/

Facts

Skill name
bio-read-qc-adapter-trimming
GitHub stars
1.2k
Used in
1 other repo
Token cost
~2.9k tokens
SKILL.md length
1,261 words
Files
3
Skills in repo
559
Repo updated
First seen
Licence
MIT

At a glance

Removes sequencing adapters from FASTQ reads with Cutadapt and Trimmomatic, including paired-end read-through, small-RNA 3' adapters, amplicon primers, and anchored/linked adapters.

  • Works in 3 steps: Adapter appears only when the insert is… → Adapter trimming is the one… → Small-RNA inverts the logic: the adapter…
  • FastQC shows adapter content climbing toward the 3 end
  • SKILL.md covers Version Compatibility, The Single Most Important…, Verified Adapter Sequences and Tool Taxonomy, plus 6 more sections
  • Runs Shell scripts from its folder

What it does

Bio Read Qc Adapter Trimming is an agent skill from GPTomics/bioSkills. Removes sequencing adapters from FASTQ reads with Cutadapt and Trimmomatic, including paired-end read-through, small-RNA 3' adapters, amplicon primers, and anchored/linked adapters. Use when FastQC shows adapter content climbing toward the 3' end, when inserts are shorter than the read length (small-RNA, cfDNA, FFPE), or before assembly/k-mer analysis. For all-in-one trimming use fastp-workflow; for quality/length filtering use quality-filtering.

Its SKILL.md is about 2.9k tokens, which your agent loads only when the skill is triggered. The skill folder holds 3 other files (for example `examples/trim_adapters.sh` and `usage-guide.md`).

It sits in Research & Science. The repository describes itself as: a set of SKILLS.md for doing bioinformatics with agents like claude code. The licence is MIT.

When your agent uses it

  • FastQC shows adapter content climbing toward the 3 end
  • Inserts are shorter than the read length (small-RNA
  • Before assembly/k-mer analysis

Example prompts

  • “Use the bio-read-qc-adapter-trimming skill to remove sequencing adapters from FASTQ reads with Cutadapt and Trimmomatic, including paired-end…”
  • “/bio-read-qc-adapter-trimming”

Requirements

  • A Bash shell

Workflow steps

3 steps, taken from the first numbered list in SKILL.md.

  1. Adapter appears only when the insert is shorter than the read, so adapter content is a direct readout of the insert-size distribution…
  2. Adapter trimming is the one near-universal preprocessing step; quality trimming usually is not. Local aligners (BWA-MEM, STAR, Bowtie2…
  3. Small-RNA inverts the logic: the adapter is on EVERY read, so DISCARD reads with no adapter. A ~22 nt miRNA insert is far shorter than a…

What it can do on your machine

Read from SKILL.md and the folder at commit d91ed3d. It shows what the files ask for, not the result of running them.

  • Tool permissions

    Pre-approves nothing: there is no allowed-tools line, so your agent's usual permission prompts apply.

    From allowed-tools in the SKILL.md frontmatter.

  • Runs code

    Ships script files (Shell), which the agent can run.

    From the folder's file list and the shell code blocks in SKILL.md.

  • Network

    No URLs in SKILL.md.

    From URLs in SKILL.md, links to its own repository left out.

  • Credentials

    Names no API keys, tokens, secrets or passwords.

    From names ending in _API_KEY, _TOKEN, _SECRET, _KEY or _PASSWORD in SKILL.md.

Context cost

Bio Read Qc Adapter Trimming loads about 2.9k tokens when it runs. Until then it costs about 120 tokens; SKILL.md has 1,261 words of instructions outside code blocks.

Always · name and description, kept in context so the agent knows when to use it
~120
When it runs · the whole SKILL.md, loaded when a task matches
~2.9k

Estimates: characters ÷ 4, the usual rule of thumb; real counts depend on the model's tokenizer. Scripts and assets cost tokens only if the agent reads them.

Safety

Auto-check passed

The automated check found no risky patterns in SKILL.md.

Automated static check — not a guarantee. Review scripts before installing. It scans the text of SKILL.md for risky patterns (piping downloads into a shell, reading credential files, hidden Unicode, destructive commands); files beside SKILL.md are not scanned.

SKILL.md

The full file from GPTomics/bioSkills at commit d91ed3d, republished under its MIT licence (© GPTomics). 1,261 words, ~2,905 tokens.

Download SKILL.mdSave it as .claude/skills/bio-read-qc-adapter-trimming/SKILL.md (or your agent's skills folder). This skill also uses 2 other files; get the full folder from GitHub.
name
bio-read-qc-adapter-trimming
description
Removes sequencing adapters from FASTQ reads with Cutadapt and Trimmomatic, including paired-end read-through, small-RNA 3' adapters, amplicon primers, and anchored/linked adapters. Use when FastQC shows adapter content climbing toward the 3' end, when inserts are shorter than the read length (small-RNA, cfDNA, FFPE), or before assembly/k-mer analysis. For all-in-one trimming use fastp-workflow; for quality/length filtering use quality-filtering.
tool_type
cli
primary_tool
cutadapt

Version Compatibility

Reference examples tested with: Cutadapt 4.4+, Trimmomatic 0.39+, fastp 0.23+, FastQC 0.12+

Before using code patterns, verify installed versions match. If versions differ:

  • CLI: <tool> --version then <tool> --help to confirm flags

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

Adapter Trimming -- adapter content IS the insert-size distribution

Remove adapter sequence that the polymerase read INTO once it ran off the end of a short insert, using Cutadapt (precise, the correctness reference) or Trimmomatic (palindrome mode for paired read-through).

"Trim adapters from my reads" -> Detect and remove 3' adapter introduced by read-through, then length-filter the survivors.

  • CLI: cutadapt -a AGATCGGAAGAGC -A AGATCGGAAGAGC -m 20 -o R1.fq -p R2.fq in_R1.fq in_R2.fq
  • All-in-one alternative: fastp (PE overlap analysis needs no adapter sequence) -> read-qc/fastp-workflow

Scope: this skill OWNS adapter/primer removal. Quality and length filtering -> read-qc/quality-filtering. Single-pass trim+QC -> read-qc/fastp-workflow. Contaminant/PhiX k-mer removal -> read-qc/contamination-screening. OUT OF SCOPE: quality-score trimming as a standalone goal (usually unnecessary before soft-clipping aligners; see insight 2).

The Single Most Important Modern Insight

  1. Adapter appears only when the insert is shorter than the read, so adapter content is a direct readout of the insert-size distribution -- and adapter trimming is 3'-only for standard Illumina. The library is [P5]-[insert]-[P7]; a read primes at the insert boundary and reads 5'->3' into the insert, running into the 3'/P7-side adapter only if it runs out of insert. Short-insert libraries (small-RNA ~22 nt, cfDNA ~167 bp, FFPE, degraded RNA, ancient DNA) are read-through-dominated; long-insert WGS may show almost none. The FastQC adapter-content curve climbing toward the 3' end IS that insert-size signal.

  2. Adapter trimming is the one near-universal preprocessing step; quality trimming usually is not. Local aligners (BWA-MEM, STAR, Bowtie2 local, HISAT2) SOFT-CLIP low-quality tails, so quality trimming is redundant or harmful for alignment-based DNA/RNA (MacManes 2014, Williams 2016; GATK discourages it before BQSR). But aligners do NOT reliably remove ADAPTER -- adapter is foreign sequence with genuine base quality, so the aligner may try to align it and anchor a wrong placement. Trim adapter; leave quality trimming to the cases that need it (assembly, k-mer/pseudo-alignment, small-RNA, amplicon, no-BQSR variant calling).

  3. Small-RNA inverts the logic: the adapter is on EVERY read, so DISCARD reads with no adapter. A ~22 nt miRNA insert is far shorter than a 50-75 nt read, so read-through is universal; a read with no detectable adapter is an adapter dimer, a too-long contaminant, or junk. Use --discard-untrimmed plus a tight length gate (-m 18 -M 30). This is the OPPOSITE of genomic DNA, where the no-adapter reads are the good full-length inserts.

Two-color trap: on NextSeq/NovaSeq, a high-quality poly-G tail is NOT adapter and is not removed by adapter trimming -- it needs a chemistry-aware poly-G trim (cutadapt --nextseq-trim=20, or fastp's auto poly-G). See read-qc/quality-reports and read-qc/fastp-workflow.

Verified Adapter Sequences

KitReadSequence
Illumina TruSeqR1 3'AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Illumina TruSeqR2 3'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
TruSeq (shared stem -- catches both)--AGATCGGAAGAGC
Nextera / Tn5transposaseCTGTCTCTTATACACATCT
TruSeq small-RNA3'TGGAATTCTCGGGTGCCAAGG

The R1 3' adapter is the reverse complement of the R2-side region; trimming the shared 13 bp stem AGATCGGAAGAGC on both mates catches TruSeq read-through.

Tool Taxonomy

ToolMechanismWhen it wins
CutadaptError-tolerant semiglobal alignment of a supplied adapterPRECISION: small-RNA 3' adapter, amplicon/16S primers, anchored/linked adapters, demultiplexing. The correctness reference.
TrimmomaticILLUMINACLIP simple + palindrome modes; ordered step pipelineLegacy/reproducibility pipelines; palindrome PE read-through detection
fastpPE overlap analysis (no adapter sequence needed) + auto poly-GDEFAULT general-purpose trim; one fast pass (route OUT -> fastp-workflow)
Trim GaloreCutadapt + FastQC wrapper with adapter auto-detectBisulfite/RRBS (--rrbs), Bismark pipelines
BBDukk-mer match against an adapter/contaminant referenceContaminant/PhiX removal in the same pass (route OUT -> contamination-screening)

Decision Tree by Scenario

ScenarioUseWhy
General Illumina PE WGS/WES/RNAfastp, or cutadapt with the TruSeq stemOverlap analysis needs no sequence; cutadapt for explicit control
Small-RNA / miRNAcutadapt -a TGGAATTCTCGGGTGCCAAGG -m 18 -M 30 --discard-untrimmedAdapter on every read; gate length and drop no-adapter reads
Amplicon / 16S primerscutadapt linked/anchored adaptersPrimers are at fixed positions; needs precise placement
PE read-through, no adapter sequence knownfastp overlap, or Trimmomatic palindromeBoth detect read-through from the R1/R2 overlap
Bisulfite / RRBSTrim Galore --rrbsHandles MspI fill-in and Bismark conventions
NextSeq/NovaSeq with poly-G tailsfastp (auto) or cutadapt --nextseq-trimPoly-G is high-Q; quality trim alone misses it

Default when uncertain: fastp for bulk PE, cutadapt with the TruSeq stem for explicit single-tool control.

Show full SKILL.md (523 more words)Show less

Cutadapt

The algorithm is semiglobal (overlap) alignment, so a partial 3' adapter at the read end is detected. Two defaults drive behavior: -e (error rate, default 0.1) is computed against the LENGTH OF THE MATCHED REGION, not the whole adapter (an 8 bp match with 1 error is rate 0.125 and is rejected at the default); -O (minimum overlap, default 3) costs only ~0.07 bases lost per read by chance.

bash
# Single-end 3' adapter
cutadapt -a AGATCGGAAGAGC -m 20 -o trimmed.fq.gz in.fq.gz

# Paired-end TruSeq (shared stem on both mates); both reads of a pair are discarded together
cutadapt -a AGATCGGAAGAGC -A AGATCGGAAGAGC -m 20:20 \
         -o R1.fq.gz -p R2.fq.gz in_R1.fq.gz in_R2.fq.gz

# Small-RNA: adapter on every read -> discard untrimmed, gate length
cutadapt -a TGGAATTCTCGGGTGCCAAGG -m 18 -M 30 --discard-untrimmed -j 8 \
         -o mirna.fq.gz raw.fq.gz

# Amplicon: linked 5'...3' primers (anchor with ^ to require the 5' primer)
cutadapt -g ^FWDPRIMER...REVPRIMER -o trimmed.fq.gz in.fq.gz

# 2-color poly-G aware (treats G as low quality so high-Q poly-G is trimmed)
cutadapt --nextseq-trim=20 -a AGATCGGAAGAGC -m 20 -o out.fq.gz in.fq.gz

# Higher error tolerance / longer required overlap when matches are missed / spurious
cutadapt -a ADAPTER -e 0.15 -O 5 -m 20 -o out.fq.gz in.fq.gz

Key flags: -a/-g/-b (3'/5'/anywhere, R1), -A/-G/-B (R2), -q (quality trim, BWA running-sum, runs BEFORE adapter removal), --pair-filter {any,both,first} (default any), --max-n, --action {trim,mask,lowercase,none}. When a filtering option discards reads in PE mode, both files MUST be processed together or they fall out of sync.

Trimmomatic

ILLUMINACLIP:<adapters.fa>:<seedMismatches>:<palindromeClip>:<simpleClip>:<minAdapterLen>:<keepBothReads>

  • seedMismatches: mismatches tolerated in the initial seed (commonly 2).
  • palindromeClip (~30): log-odds threshold for the PE palindrome alignment; ~30 needs ~50 matched bases.
  • simpleClip (~10): log-odds threshold for an adapter-vs-read match; ~10 needs ~16 bases.
  • keepBothReads: DEFAULT False -- after palindrome detects read-through, R2 is redundant (reverse complement of R1) and is DROPPED; set True if a downstream tool needs both mates.

SIMPLE mode tests each adapter against each read. PALINDROME mode (PE-only) aligns R1+adapter against the reverse complement of R2+adapter, so it detects read-through even when only a few adapter bases remain or the adapter is entirely past the read end. Steps run in COMMAND-LINE ORDER; put ILLUMINACLIP first and MINLEN last so the length check reflects all prior trimming.

bash
# Paired-end, palindrome-capable adapter file, MINLEN last
trimmomatic PE -phred33 -threads 8 \
    in_R1.fq.gz in_R2.fq.gz \
    R1_paired.fq.gz R1_unpaired.fq.gz R2_paired.fq.gz R2_unpaired.fq.gz \
    ILLUMINACLIP:TruSeq3-PE-2.fa:2:30:10:2:keepBothReads MINLEN:36

# Built-in adapter files ship with the install
ls $CONDA_PREFIX/share/trimmomatic-*/adapters/

PE mode emits FOUR files: paired (both mates survived) and unpaired/orphan (mate dropped). Feed the paired files to the aligner; the orphans stay synchronized out of the way.

Common Errors

SymptomCauseSolution
FastQC still shows adapter after trimmingWrong adapter, too-low -e, or only partial stem usedUse the shared stem AGATCGGAAGAGC; raise -e to 0.15; BLAST the overrepresented sequence
Reads truncated / many lose a few bp-O too low -> random 3-mer matchesRaise -O (e.g. 5); the default loses ~0.07 bp/read by chance
Aligner reports R1/R2 out of syncMates trimmed/filtered independentlyProcess pairs together (cutadapt -p; Trimmomatic paired outputs)
Small-RNA yields huge "reads"Forgot --discard-untrimmed / length gateAdd --discard-untrimmed -m 18 -M 30
3' G-content rise persists after trimming2-color poly-G is high-quality, not adaptercutadapt --nextseq-trim or fastp auto poly-G
Half of R2 disappears in TrimmomatickeepBothReads default False drops redundant R2Add keepBothReads (True) if both mates are needed downstream

References

Martin M. 2011. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal 17(1):10-12. Bolger AM, Lohse M, Usadel B. 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30(15):2114-2120. MacManes MD. 2014. On the optimal trimming of high-throughput mRNA sequence data. Frontiers in Genetics 5:13. Williams CR, Baccarella A, Parrish JZ, Kim CC. 2016. Trimming of sequence reads alters RNA-Seq gene expression estimates. BMC Bioinformatics 17:103. Chen S, Zhou Y, Chen Y, Gu J. 2018. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 34(17):i884-i890.

read-qc/quality-reports - Read the adapter-content panel that triggers trimming read-qc/quality-filtering - Quality and length filtering after adapter removal read-qc/fastp-workflow - All-in-one adapter + quality trim with auto poly-G read-qc/contamination-screening - k-mer removal of PhiX/vector/contaminant sequence small-rna-seq/smrna-preprocessing - Full small-RNA adapter + length workflow read-alignment/bwa-alignment - Soft-clipping aligner that handles low-quality tails without trimming

© GPTomics, MIT. Rendered from Markdown: HTML in the file is shown as text, images as links, and headings moved down two levels. Raw file

Files

SKILL.md and 2 other files in read-qc/adapter-trimming of GPTomics/bioSkills.

  • SKILL.md
  • examples/trim_adapters.sh
  • usage-guide.md

Open the folder on GitHubat commit d91ed3d

Used in 1 other repository

We found 1 copy of this SKILL.md (exact, near-identical or edited) in other folders, from 1 other GitHub owner. This page covers the copy in GPTomics/bioSkills, which our catalogue first saw on October 7, 2026.

Compare with similar skills

Bio Read Qc Adapter Trimming next to the 5 skills that share the most tags, products or categories with it. Stars are the repository's; “used in” counts other GitHub owners with a copy.

Bio Read Qc Adapter Trimming compared with similar skills
SkillStarsUsed inTokensAuto-checkLicenceRepo updated
Bio Read Qc Adapter Trimming this skillGPTomics/bioSkills1.2k1 repos~2.9kAutomated safety check: PassMIT
Hypothesis Generationspacering-net/codeg3.9k14 repos~3.6kAutomated safety check: NotesMIT
GitHub Deep Researchbytedance/deer-flow84k4 repos~1.3kAutomated safety check: PassMIT
Nature Paper CardYuan1z0825/nature-skills47k2 repos~2.1kAutomated safety check: PassApache-2.0
Content Research Writerweapp-tailwindcss/weapp-tailwindcss1.9k25 repos~3.5kAutomated safety check: PassMIT
Last30daysmvanhorn/last30days-skill64k—~7.9kAutomated safety check: NotesMIT

Similar skills

  • Hypothesis Generation

    spacering-net/codeg

    Structured hypothesis formulation from observations. An agent skill from spacering-net/codeg.

    3.9k GitHub starsUsed in 14 repos~3.6k tokens
    Research & ScienceAuto-check: notes

  • GitHub Deep Research

    bytedance/deer-flow

    Researches a GitHub repository over four rounds using the GitHub API and web search, then writes a structured markdown report with timeline, metrics and Mermaid diagrams.

    84k GitHub starsUsed in 4 repos~1.3k tokens
    Research & ScienceAuto-check passed

  • Nature Paper Card

    Yuan1z0825/nature-skills

    Builds a structured deep-reading card for one scientific paper, covering methods, how experiments support claims, limitations and research ideas, with a script to prepare the source.

    47k GitHub starsUsed in 2 repos~2.1k tokens
    Research & ScienceAuto-check passed

  • Content Research Writer

    weapp-tailwindcss/weapp-tailwindcss

    Assists in writing high-quality content by conducting research, adding citations, improving hooks, iterating on outlines, and providing real-time feedback on each section.

    1.9k GitHub starsUsed in 25 repos~3.5k tokens
    Research & ScienceAuto-check passed

  • Last30days

    mvanhorn/last30days-skill

    Research what people actually say about any topic in the last 30 days.

    64k GitHub stars~7.9k tokensUpdated yesterday
    Research & ScienceAuto-check: notes

  • Peer Review

    spacering-net/codeg

    Structured manuscript/grant review with checklist-based evaluation.

    3.9k GitHub starsUsed in 17 repos~5.9k tokens
    Research & ScienceAuto-check: notes

More from GPTomics/bioSkills

All 559 skills in this repo

  • Bio Alignment Io

    GPTomics/bioSkills

    Read, write, and convert multiple sequence alignment files using Biopython Bio.AlignIO.

    1.2k GitHub starsUsed in 3 repos~4.9k tokens
    Auto-check passed

  • bioSkills Installer

    GPTomics/bioSkills

    Installs the bioSkills collection of 425 bioinformatics skills in one step, or only chosen categories, so sequencing, RNA-seq, single-cell and variant tasks get specialized help.

    1.2k GitHub starsUsed in 1 repo~789 tokens
    Auto-check passed

  • Bio Write Sequences

    GPTomics/bioSkills

    Write biological sequences to files (FASTA, FASTQ, GenBank, EMBL) using Biopython Bio.SeqIO.

    1.2k GitHub starsUsed in 3 repos~2.1k tokens
    Auto-check passed

  • Amplicon Primer Clipping

    GPTomics/bioSkills

    Soft- or hard-clips PCR primer footprints from aligned amplicon BAMs so primer bases stop masquerading as confirmed reference sequence.

    1.2k GitHub starsUsed in 2 repos~2.2k tokens
    Auto-check passed

  • Alignment Filtering with samtools and pysam

    GPTomics/bioSkills

    Filters BAM alignments by FLAG bits, mapping quality and regions with samtools view or pysam, with recipes for common keep and drop cases.

    1.2k GitHub starsUsed in 2 repos~3.6k tokens
    Auto-check passed

  • Bio Alignment Indexing

    GPTomics/bioSkills

    Create and use BAI/CSI indices for BAM/CRAM files using samtools and pysam.

    1.2k GitHub starsUsed in 2 repos~2.4k tokens
    Auto-check passed

Categories

Questions about Bio Read Qc Adapter Trimming

What does Bio Read Qc Adapter Trimming do?

Removes sequencing adapters from FASTQ reads with Cutadapt and Trimmomatic, including paired-end read-through, small-RNA 3' adapters, amplicon primers, and anchored/linked adapters. Bio Read Qc Adapter Trimming is an agent skill from GPTomics/bioSkills. Removes sequencing adapters from FASTQ reads with Cutadapt and Trimmomatic, including paired-end read-through, small-RNA 3' adapters, amplicon primers, and anchored/linked adapters.

When should I use Bio Read Qc Adapter Trimming?

Bio Read Qc Adapter Trimming fits situations like: fastQC shows adapter content climbing toward the 3 end; inserts are shorter than the read length (small-RNA; before assembly/k-mer analysis.

How do I install Bio Read Qc Adapter Trimming in Claude Code?

Run `npx skills add GPTomics/bioSkills --skill bio-read-qc-adapter-trimming -a claude-code`. Or copy the skill folder (read-qc/adapter-trimming in GPTomics/bioSkills) into .claude/skills/bio-read-qc-adapter-trimming in your project. Claude Code loads it when a task matches its description.

How do I install Bio Read Qc Adapter Trimming in Codex?

Run `npx skills add GPTomics/bioSkills --skill bio-read-qc-adapter-trimming -a codex`. Or copy the skill folder (read-qc/adapter-trimming in GPTomics/bioSkills) into .agents/skills/bio-read-qc-adapter-trimming in your project. Codex loads it when a task matches its description.

Can I use Bio Read Qc Adapter Trimming in Cursor, Gemini CLI or GitHub Copilot?

Cursor, Gemini CLI, GitHub Copilot and OpenCode also load SKILL.md folders. With the skills CLI, run `npx skills add GPTomics/bioSkills --skill bio-read-qc-adapter-trimming -a cursor` (or -a gemini-cli, github-copilot or opencode for the others). To copy it by hand, put the folder in .cursor/skills/bio-read-qc-adapter-trimming, .gemini/skills/bio-read-qc-adapter-trimming, .github/skills/bio-read-qc-adapter-trimming and .opencode/skills/bio-read-qc-adapter-trimming in your project.

What does Bio Read Qc Adapter Trimming need to run?

Going by SKILL.md and its folder, Bio Read Qc Adapter Trimming needs a shell for the scripts in its folder. Our summary lists: A Bash shell.

Does Bio Read Qc Adapter Trimming access the network?

SKILL.md contains no URLs. Any network use would come from the scripts or tools the agent runs. This is read from the text; nothing was executed.

Is Bio Read Qc Adapter Trimming safe to install?

Our automated static check of SKILL.md found no risky patterns, such as piping downloads into a shell, reading credential files or hidden Unicode. It is not a guarantee. Review the folder before installing.

What licence does Bio Read Qc Adapter Trimming use?

Bio Read Qc Adapter Trimming is published under the MIT licence (the repository's licence). It allows redistribution, so the full SKILL.md is shown on this page.

How many tokens does Bio Read Qc Adapter Trimming use?

About 2.9k tokens (SKILL.md is roughly 12k characters). Agents keep only the skill's name and description in context until a task matches; then they load SKILL.md in full.

What are the alternatives to Bio Read Qc Adapter Trimming?

Skills that share tags, products or a category with Bio Read Qc Adapter Trimming: Hypothesis Generation (spacering-net/codeg, 3.9k stars), GitHub Deep Research (bytedance/deer-flow, 84k stars), Nature Paper Card (Yuan1z0825/nature-skills, 47k stars) and Content Research Writer (weapp-tailwindcss/weapp-tailwindcss, 1.9k stars). The comparison table on this page puts their stars, adoption, token cost, safety result and licence side by side.

Who maintains Bio Read Qc Adapter Trimming?

GPTomics (a GitHub organization) maintains it in GPTomics/bioSkills, which has 1,218 GitHub stars. The repository holds 559 skills in this directory. The repository was last updated on August 15, 2026.

Source: GPTomics/bioSkills on GitHub. Facts on this page come from the repository at the commit we read; the author's words are quoted as theirs.